realDB: A Genome Database for Red Algae

known miRNA miRNA seq length (nt)
miR1026a UGAGAAAGAAUUGAAGGCAU 20
miR1033a UGCGGUCGAGAUGGGCUACU 20
miR1070 UACGGUUUCUAGAAACUUC 19
miR1077-5p UUAACUUUUCGGAUCGCGUGC 21
miR1115-5p UGAGGUAAGAGCAUUUGGUGG 21
miR1122 UAGAGCAUCUGUAUUUGGCA 20
miR1157-3p UUCAGGUGGGGGACACAGUG 20
miR1169-5p UAUCCAGCAAGAUCUCGACA 20
miR1219d UUUCCUUGCCUCUACUUCUU 20
miR1220a UUACGGUGGAGAGGAAGAAG 20
miR1221-5p UGGAUAUGUGCAGGGUAAUAA 21
miR1427 UGCGGAACGGUGGGCGUGGGC 21
miR1507a UCUUCCAUUACGUCAUCU 18
miR1509a UAAUCAAGGAAUCGACGUCG 20
miR156c UUGACAGAAGAGAGAGAGCAC 21
miR156g-3p UUCUUACCUCUUCUGUCUCC 20
miR157a-5p UUGACAGAAGAUAGAGAGCAC 21
miR158-3p UUUCCAAAGUCGACCAAGCA 20
miR159a.2 UACAUGCCCCAGGAGCUCGGA 21
miR160a-3p UGCGUAUGAGGAGCAAGGUUA 21
miR161.2 UCAUGAUUGAAAGGACAA 18
miR164 UGGAGAAGUGGGAGAACGUGU 21
miR166h-3p UUCGGACCUGGCUUCUUGC 19
miR166u UCUGGACCAGGCUUUAAAUUC 21
miR167a UGAAGCUGCCAGCAUGAUCUAA 22
miR168b UACGCGUAGGUCAGGUCGGG 20
miR169e UAGCCAAGAGAACUGACAACG 21
miR172f UGACUGCUUGAUGUGCCGUAC 21
miR1850.2 UUGUGUGGAUCGAAACGUGG 20
miR1855 AGGACUGGAAAGUAGCAACAAGAGA 25
miR1857-3p UCAUGAUCCAACGAAAACCGU 21
miR2083-5p UUCUUCACUACGCUCAUCUCU 21
miR2095-5p UGAAAUUUUACGAUGAAGACG 21
miR2109-5p UGCGAGUGUCGUCGCAUGCU 20
miR2119 UCAAGGGAGAUGUGGGGAGA 20
miR2275a-5p UCAGUGGCGAGAGAAAGCAA 20
miR2616 AUUCGUUUGGAUCGGGCGGA 20
miR2636 UUUGGUUAUGUAGAUGCAAUAU 22
miR2667a UCCAUGAUCUGACGGUAGCG 20
miR2880 ACUGAUCCCGUCGGCACGGAUG 22
miR2916 GGGGAUCGAAGACGAUCAGA 20
miR2925 UGGCUGGCUGUGGCUUCGU 19
miR2934-5p UCUCUUGCAAACGUUGGA 18
miR319c AUCCAUCGAUGCAGGAGCUGA 21
miR3440 UCGGUUGGUCAAGGAAACU 19
miR3447-3p UUUAGUUUGUUUGUGUAGAA 20
miR3476 UCGCGACUGGGAUUUGUUGGAA 22
miR3517 UGACAUUGUGGAUCCCGGAA 20
miR3624-3p UCAGAACAGCAGCAACACU 19
miR3627b UGUCGCAGGAGAGCCGCGCA 20
miR3706 UUCGGAGACAUGUAAUAAGA 20
miR391-5p UGUCGCAGGAGAGCCGCGCCA 21
miR394b-3p AGGUGGGGAUGACGUCAAGU 20
miR395x GGUGAAGUGUUUGGAUUGCGC 21
miR396a-3p UCAAUAAAGCGUGCGACAG 19
miR396c UUCAAGAAGAUUGUCGGGAUG 21
miR397b UCAUUGUCGUGAUCGUUGAG 20
miR3982-3p UUUGACUACAUGGAGCGCA 19
miR398a-5p UGGAAGUCAUGAGAACAGGGA 21
miR399d UGCAGGAGAUUUGCUCGUA 19
miR408b-5p UACGGGCACGACACAGAGCAU 21
miR414 UGCACCUCUUCAUAUCGUCC 20
miR416 UGAUUCGUCAGAGACUGUUCA 21
miR419a UUAUGAAUGAUGAGAUCGUGG 21
miR4228 ACAGACUUGAACGUGCGUU 19
miR4240 UGACUAGACCCGACGAUUGAC 21
miR4365 AAGAACUCCUUCCGGGACGCA 21
miR4386 UGAAGUUCUGGAAGAGGACGC 21
miR439a UGUCGAACCGUCGGUGCUCGUA 22
miR4401b UGAAAUAGUUGACUGAGGUAA 21
miR4404 UUCGGGAAGUCAUGGCGGACAA 22
miR4414b UCGAGAAGAUGUGGGAGCUAA 21
miR477h UUCGACUCAGAAGGCUUCCA 20
miR482-5p GCAUGGGAUAUUGGAAGA 18
miR4994-3p UAAUUCUAGAGCUAAUACA 19
miR5021a UAGAAGAGCGAAGAAGAGAA 20
miR5026 UCUCAUAAAUCGGAUCACGU 20
miR5031 UUAAUAUGAACUGUCUAAUUU 21
miR5041-3p UGGAGAAGUUGAAGAUUGAA 20
miR5054 UCCGCAUUGGUCGGCGUCCA 20
miR5065 UUGGCAAUACUUAUAAACU 19
miR5076 GAAUGUGGAGCAGACGGGUUU 21
miR5139 AAACCGGCGAUGAUACCA 18
miR5175-5p UUCCAAAAUAACUCGUCGGAU 21
miR5178-3p UUAUGACCGGGGGCAUGAGCG 21
miR5202 UUACGACAGUUAAAUCUCA 19
miR5225c UCUGUCGUCGGUGGAAGGUG 20
miR5246 UUGCAGGACAGCUCGAGGUU 20
miR529b UGCAGAGCAGAAGUACAGCUU 21
miR5302a AAAGAGGAGUUUGUUCUUUGG 21
miR5337b CAGAACUGCAAGCAUUUAA 19
miR535b UAGACAAGGAGAGGACACG 19
miR536 UUAUCAAGCUGUGUGCACC 19
miR5369 UGAAGAACAGAGGAUGGCA 19
miR5524 UGGAAAAUGUUUCAGUUGG 19
miR5526 ACAGGUAGGUAGGUAGAG 18
miR5558-3p UAAGAUAAGAAUUAGAAAAGU 21
miR5562-3p UAUGUGGGAGAAGGCUGUAA 20
miR5564b UACAAUUCGUCGUACACUUGA 21
miR5565f UAGUCGAUUGUAAUAUCAAAC 21
miR5647 UCAAGUUUGAGUGUCGUCCA 20
miR5656 ACUGAAGUGGAGAAGGGUU 19
miR5660 UAGGUGGUUAGUCAAGCAA 19
miR5675 UAGGGCAACAAACAAUGGAAA 21
miR5719 UUGAUGAUAAAGGACUUC 18
miR5766 UUCGAGGUAGAAGAGGCAAGG 21
miR5778 CGAGAACUGUUCGUCGUAUC 20
miR5791 UUGAGAGACUCGCAGACCAG 20
miR5804 UGAGAAGAGGUUGCCGACU 19
miR6108f UAGGGUUAAAGGGUAAGAA 19
miR6113 UCCUGAAACCACGAACACGUU 21
miR6135k UUGUCGAAACUGUAUUGCGU 20
miR6148b UGUUUUUAAUCGUUUGUCACA 21
miR6149a UUGCAUACGCACCUGAAUCGG 21
miR6161d UAACGGCAGCAUAUUAUCU 19
miR6167 UACCCAGGUGGAGCUUCUUU 20
miR6168 UCUUGCGGCGGUGGAUGCAUG 21
miR6173 UUAGCUGUAAACGAUGGAUAC 21
miR6177 UACCGAUGGACGAACGGCACUU 22
miR6183 UGAGACGAGAUGGCUGCAGUU 21
miR6185 UCUGAGGGACGCGGAACAUA 20
miR6194 UAGGGGAUCGAAGACGAU 18
miR6196 AGGACGAGGAAAUAGGAGG 19
miR6207 UGGACGUCUGGAGCGCCGAUG 21
miR6230-3p UUACGAGUUUAGGAUCUGA 19
miR6233-5p UGUUGAGGCUUGGAGCGUGAUGG 23
miR6247 UGGAUAUUGAACAAUGGCA 19
miR6266a UACAUGGCAGGGGAAAAUGA 20
miR6267a UAGAAGCGGUGGUACCUUGUG 21
miR6284 UCUUGGACCUGGAUGGAGAUC 21
miR6285 UGUGAAUGUUUGAACUGGGCU 21
miR6292 UGUUUUUAAUCGUUUGUCA 19
miR6450b CGCACUCAGGACUUCAAGGCA 21
miR6469 UGGCAGAAUCGAUUCAGUUUA 21
miR6476a UCACUGGAGAUGGAAACGUA 20
miR6485 UAGGAGUGGAUAGCAUAA 18
miR7120a UGAUUAUCGAUCAGAUUGUCA 21
miR7484h UUUCGUAGAAGUGGAUGA 18
miR7486d UGGGGCGCGCUAUUUACG 18
miR7492e UCAUGAUCUUCGAGCGGCUUU 21
miR7494e UCGUGAUCGUUGAGCGUGCUU 21
miR7502e UUUCGUAGAAGUGGAUGAA 19
miR7536a UUCAAGACGUGCCAAGAGUG 20
miR7540a UUGAUGUGAUGUGAUGUGA 19
miR7696a-3p UGAAUUAUGAGAACGUGGAG 20
miR7697-3p UACCGGUCGAAUAAUCGGAUA 21
miR7719-3p UAGAAGCAUCUAUGGCGGU 19
miR774b-5p UGAGAUAAGAUAUCGGUGACG 21
miR7753-3p UGUGCAAGGAGAGACAUGGU 20
miR7774-5p ACCCAUGGCUGGACGAUGGCAAC 23
miR7821 UGAUGGACUCGGCAUUGUGA 20
miR7830 UGAACAGUAGAAUCGUUGCU 20
miR7837 UGUGUGGAGCGGGUGGUAGCU 21
miR8125 CAGGAAAGAGUGGAUGAGGAU 21
miR8142 UGAGGAUAGAUCAUAAAGGUU 21
miR8154 UAGAGGAGGAGAGAAGAAGA 20
miR8155 UAACCGGCGAUGAUACCA 18
miR8180 CGCGUGCGGGAUGAAGGC 18
miR820a UCGGGCUCGUGGAUGCCGG 19
miR822-5p UGCGGAAGCAGUUGACAUGA 20
miR835-5p UUCUUGCAGAGUUCUUUCC 19
miR841b-3p CAAUUUUUUGGGGUCGUUU 19
miR847-5p UCUUGAUGAGAAACGAAUGAA 21
miR859 UACUCUCUGUUGGAAAUCAA 20
miR8601 UCCAUUAAGGUGUCGGAGUUU 21
miR862-5p UCCAAGAUGGUCGAGCAAGGC 21
miR8633 UAAGGGCGAAGAGGUAGGUU 20
miR863-3p UUGGAGCAACAGACAAUAU 19
miR8638 UGAAAAGGAAUGGCUCUAA 19
miR8648 UUUGGCCAGUAGAAGCGAUU 20
miR8663b UGGGCAUGAAGUUGGCAAUGU 21
miR8664 UGUAGUCAAGUGGGACGGACA 21
miR866-5p UCAUGGGACGGAUUUUGUU 19
miR8718 UUUUGGAAGAAUGUCAUCUCG 21
miR8719 CAAACGGAACUGGGACAGGUAA 22
miR8740 UAAUGAUGGGCACGUAGUA 19
miR8746 UGCAUUUUCACGAUCUCUUCA 21
miR8755 UGAGCCGCUUGCUGACGUGGCA 22
miR893 AAAGGGACUUGUGCGGAC 18
miR902a-5p UAUGAUGAAAGAUUGUUCGA 20
miR907 UUUCUGCGAGCGGUUCUGCGC 21
miR9411 UAUGGACGCGUACACGGAACG 21
miR948 UCGGCGUGUGGGAUCCGGAA 20
miR9484 UAGGCAAGGGAAGUCGGC 18
miR9485 UUAUGACAGUGUGGAGUACA 20
miR951 UAUCCUUGCGUCUGGACACAC 21
miR9552a-3p UGACCAAGUAGACACGAUAA 20
miR9559-5p UCUGGUUUUGUGUAUUGUUG 20
miR9563a-3p UAAAGUUGACAGUACAAGUUA 21
miR9653a-3p UUUGAACUUUGGCCAGAGGCA 21
miR9654b-3p UUCGAAAGGUUUGAGAGCGAGCAU 24
miR9722 UUAGAGCGGAAGAAGAAGAA 20
miR9748 GGAGGAAGGUGGGGAUGAC 19
miR9778 UGCCUCUCUCAAAGCUCGUCG 21

    Data Sources:Gao et al., 2016, BMC Genomics

known miRNA miRNA seq length (nt)
miR1028a-3p GAAAUUGUAGAUCUUCGGC 19
miR1046-5p UGGAUUUCAUACUUCUGCUUCACGA 25
miR1082a GCGAGGGCCGUGGCCGGUG 19
miR1222d UAAGCGGCUCACUGGUAUA 19
miR156a-5p UGACAGAAGAGAGUGAGCAC 20
miR157a-5p UUGACAGAAGAUAGAGAGCAC 21
miR159a.1 UUGGAUUGAUGGGCGCUUG 19
miR159a-3p UUGGAUUGAUGGGCGCUU 18
miR160a-3p GCUUAUCGAGGAGCCAGCAGA 21
miR164a UGGAGAAGCAGGGCACGUGCA 21
miR166g-3p UCGGACCAGGCUUCAUUCCUC 21
miR167a UGAAGCUGCCAGCAUGAUCUGA 22
miR167d-3p AGACUCAAGUUCUGCUUCAC 20
miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21
miR169f-3p GGUUCAAGUCCGAUCCUCGGCUCCA 25
miR169t CGAUCAAGGAUGCUCGUCG 19
miR171a UGAUGAGUCGUGACAUAU 18
miR172c UGGAUCUGAUGAUGCGGCG 19
miR1858a GAAGGAGGGACGGAGUAGGC 20
miR1919a ACGAGACUGUCUGUGACGG 19
miR2592bi UGGGAACUUUGGGGAGACUGCCGGU 25
miR2592bp-3p CGAGAACUCCUGCAGUCGA 19
miR2675 GAGGCAUAUUUGAAGGCUU 19
miR2916 GGGGAUCGAAGACGAUCAGAUA 22
miR3438-5p UCAAGGACUAAGCCAUGCAAG 21
miR3448-5p UCGGAAAACAGCUUCAGCA 19
miR396g UUCUUGAACUUCGGAUGCC 19
miR397 UUGAGGCGCAGCGGUUGAUGU 21
miR408b-5p CAGCGCGAGGCGAGCAUGGA 20
miR418 UAAGGAGAUGAUGAUGACG 19
miR4387e UGUUGGUGAUAAGAGCGGUG 20
miR4414b UGUGAAGAUGCGGACUAC 18
miR473a-3p UGAGGCCUUGGGAGGGAUGG 20
miR482-5p UGGUGACAUGAAGGGCAUU 19
miR4994-3p UAAUUCUAGAGCUAAUACA 19
miR5020a UGGGAAGAAAAGGUAGACUUGUCA 24
miR5056 GGAAGACCGGUAAGAACCA 19
miR5072 CGAUUCUCCCAGCGGACCCCA 21
miR5074 GAAGUCGACCGUCGGGACC 19
miR5142 AUAUUGAGACUAAGUGGAU 19
miR5168-5p CGCGUUGGUUGUCGUGGUUCAAGCG 25
miR5179 UUUUGUCAAGACUGGCAAG 19
miR5204 GCUGGAAUGGGGUUGUAGGAC 21
miR5263 AGACUAGAACUGUAACGGG 19
miR5265 AAUGUGUUGGAAAUGGUUU 19
miR529 AGAAGGAAGAAGAUGGUUGAG 21
miR5304-3p AGAUGAGUAGGGUAGCUUGGG 21
miR535d UACGACGAGGAGAGCAAGA 19
miR5485 UGGAACAGGUAGCAGACAA 19
miR5501 ACUUGUGGCUAGGGGUGAA 19
miR5506 AGGAUCUUCGUCUGAUCGU 19
miR5515 CCAUGGUUGUCACGGGUG 18
miR5516a CUCAUUGCAUCGGAGGUUG 19
miR5565c AACUGUGGAUAGAGGUGA 18
miR5636 CGUAGUCGGAGGUUGACGG 19
miR5644 GUGGCGUUGACGGAUAACAGA 21
miR5646 GUGAAGCAAGUUGGGAGG 18
miR5661 AGAUGACUCAUGUAGGCUG 19
miR5671a CAUGGUUGUGACGGGUGAC 19
miR5769 UGGGAAAUGACGACGACGA 19
miR5794 UGAGGAAUCACUAGUAGUCGU 21
miR6028 UGGAGAGAAGGCUUCAUGA 19
miR6035 UGGGUAGAAAAUGACAGCU 19
miR6103-3p CAAGGUCGUCUUAGGCAGG 19
miR6135a UGGUAGAGUUGGUUGAUUGC 20
miR6145e AUUGUUAGAAGUAGCCGGC 19
miR6173 AGCUGUAAACGAUGGAUACUAGA 23
miR6177 UAUCGAUGGACAGAAGGCAAUUUCA 25
miR6182 UGAGUGUUGACGGAUGUUU 19
miR6194 UAAGGGGAUCGAAGACGA 18
miR6202 UGGUUUUGUAAGCAUUGAA 19
miR6209 UGGGAUCAGAAAGUGCGGCG 20
miR6214 CGACGAGGAGAGCAAGAA 18
miR6300 GUUCGUGUAGUAUAAUGGU 19
miR6421-3p AUAGAGCAAUGUAGAUAAGGGAAG 24
miR6444 UGGAAAAGUAGAGAUUGUG 19
miR6473 UGACAAUCCAGCAAGACUU 19
miR6478 GCCGACUUAGCUCAGUUGGGAG 22
miR6485 UACGAGUAGAAGAGAAUAA 19
miR7484h UUACCGUAGAAAUGGCAUG 19
miR7536a UAAGACAUGGCUCACGAAG 19
miR7740-5p UUGAACAACCACGGGCUCA 19
miR774a-5p.1 AGAGACGAAGAUUGAUGAC 19
miR7753-3p UGGGAAGGGAGAAGAGAUG 19
miR7764-5p CAUAAGCUAGUAUCUGUAC 19
miR778 UGCUUGUUUAUGUAGAUCG 19
miR7817a UUUGGUUAUUCUCUGAGACUG 21
miR7831 UACAUGUCGGACCAACAAC 19
miR8049-5p CAAGAGCUUGCAGACAUCA 19
miR8125 CAGGAAAGAAGUUAUGACGGUA 22
miR8174 UGUGAAGGUAAGCUAAUC 18
miR8175 AUUCCCGGCACGAGCGCCA 19
miR856-5p AAUUCCAGCAAUACUUCAG 19
miR8640 UCUGACACUGUGCAACUGUAAACGC 25
miR8645 UCGGUACCUUGAACUGUCACGUGCU 25
miR8671 AAUGUUGGUGAUAAGAGCGGUG 22
miR8736 GUGGCAGGUUAAGAUAGAGAAUA 23
miR8741 UCACUGAAGACGAAGAUGG 19
miR8751b UGGAAUUUGUAGACGAGUAUAAGCA 25
miR912 UGGAUUGCAUACCCAGCAGG 20
miR9471a-3p UUGGCUGAGUGAGCAUCACGG 21
miR9484 UGUGCAGGGACAAGUAGUC 19
miR9568-3p UCACAAGAGAUCUGGCAUU 19
miR9666b-3p CGGUUGGCCUGAUGAUGGA 19
miR9674a-3p GUAAGAUGGUGAACUAUGC 19
miR9748 GGAGGAAGGUAAGGAUGAC 19

    Data Sources:Gao et al., 2016, Sci Rep

known miRNA miRNA seq length (nt)
ede-miR1 AUCAUCAUCUCCUCCGCAGC 20
miR1510b-3p CACAUGGUCGGCUCCCGGAA 20
miR166a-3p UCGGACCAGGCUUCAUUCCCC 21
miR1919a CGAGAGUCAUUGUAGACGG 19
miR2667a UCCUCUGACUGACGGCUGCA 20
miR398a-5p GGUGGACCUGGAACACAAG 19
miR5821 UGGACGGAGCGUGGAGGGCCA 21
miR6463 UAGAUCAUGUUGGCGAACC 19
miR7542 AUGGGUGCUUAUGAUGGUG 19
miR8175 AUUCCCGGCACGAGCGCCA 19
miR8635 UCGGACUCAACGGUGGUAG 19
miR9663-5p AAGCGAGUGGAACGAAGUG 19
miR9666a-3p UGGGGGCUUAUGAUGGCGA 19

    Data Sources:Gao et al., 2016, RNA Biol

known miRNA miRNA seq length (nt)
miR1023 GAGAATTGGAGGGGTGCAC 20
miR1024 GTCTGGTTGGATTAGGCCAC 21
miR1026 TGAGAGAGACTTGAGACGCAG 21
miR1028 TGACATTGTAGGCAACGTTGC 22
miR1030 TCGGCACTGCACCCGCCACCA 22
miR1033 TGGCGGTCGATGGGCACT 19
miR1034 TTCCTGTGGCAGCTGCTTGCT 22
miR1037 CCTTATTGGATTGGATGG 19
miR1039 TGGGGATGACGGGCTCAGGACC 23
miR1040 TGAACCTAATGAACGATGTC 21
miR1042 GCGGCAGGAACAAGAAGG 19
miR1043 CTCGTCGACTTCATCGTGCA 21
miR1044 GCACAAAGAGGACTACACAAC 22
miR1047 TGATTATGCGATGACTGGTTG 22
miR1048 TGAAGATGATGCAGACGAC 20
miR1049 TCCTCGTCGCAAACAGTCT 20
miR1050 TGACCACCTGATTGCCGGCC 21
miR1051 GATCAACTCGAACAGGAAGA 21
miR1060 TTTTTCTAGGATTAACACC 20
miR1061 TCTAGTCAATAGAATAATG 20
miR1062 TCCCTCACCGTGGTGTCGGCAC 23
miR1064 GTGGTGATTATCATCTCTGAGGTTC 26
miR1066 ACATGCTTGCAGACGGTGGTTC 23
miR1071 GCGCAATCCCGAAGGCTGAG 21
miR1077 TGGGATGGACGTATCGCC 18
miR1082 GCTTGGCCGGCTGGGCGGG 20
miR1083 TAGCTGGAATAGCACGGT 19
miR1085 TTGATATGTTTGGATGGC 19
miR1088 CTAGAGAAAGAGACACGCA 19
miR1091 CGGCAGTGAGGGAGAGTT 19
miR1092 TGCGCGGGAACTGCATTGGTGTT 24
miR1093 TGGACGTGTTTGCCAAGA 19
miR1094 TCACTTCTCCGTCGACAGCA 21
miR1098 TGGGACGTATGTGCTGGAAAT 22
miR1100 TGGACGGAAGAACCCCCTC 20
miR1102 ACTATCGCAGCGTCAAGGA 19
miR1104 TGCAACTGTTCTTTCCTTC 20
miR1105 TTCGGATTGTGAAGACGCT 20
miR1108 TGAGTGAGAGACCCTATCCCC 22
miR1110 GTGGGGCCGTGGTCAGGGA 19
miR1111 CGCCATGACGAAGAGACCAG 21
miR1113 TGAAGTCAAAAGTAGCCT 19
miR1115 TCACCAAGAGTACCTGGCGCA 22
miR1124 GAGGACGTGTAGAGCCAGTCCC 22
miR1127 GCCTTGTTCGGAATTACT 19
miR1131 TAGGACCGGTTGGGCAACC 20
miR1137 TAGTACACCGTTGATGTTCATC 23
miR1140 ACGCCTACAATCAGTCGGAGC 22
miR1143 AAGGACGTCACCCTCACGGG 21
miR1144 TGAACCGGGACACGCAGG 19
miR1145 TGGCGATTGACCTGTCGGCGC 21
miR1146 ACTGGTCCGTCGGGAAGT 19
miR1147 TCTCGGCCGAGCTCTGCACGA 22
miR1149 TGACGTCGACATGGAGGGC 20
miR1150 TGGCTGCGCGACTGGGGCACGA 23
miR1151 ACGAGGAGTGGGACCCGGTA 21
miR1152 TCAAGAAGGGCGCGGACTTGA 22
miR1153 ACTGCTGCAGCAACTGACACG 21
miR1154 CGCCTGTGCTGACGACTGAG 21
miR1155 TGGCCTGGGACGAGGAAGGAGC 22
miR1156 TGCACCTGGGCTTCAGGCACC 22
miR1157 TACTGGAGCGGGACCGGTG 20
miR1158 ACTTGAAGGAGGCACTGGA 20
miR1159 TGCCACAGCTGCCGATGACCG 22
miR1160 TGGCAAGGAACTGAGCGGCAT 21
miR1161 TACCGGACGGTCTACAACAGC 21
miR1162 CGGCTTAATTTGACTCAACACG 23
miR1163 ACGGGCGCCAGGACGCAGC 19
miR1164 TGGTCAACAGGACCAAGTCGGCTT 25
miR1165 TACCGGTACGAGCGTCCGTCG 22
miR1166 TGGACATCACAGGCCCTGAGG 22
miR1168 TTGGACAAGGCCAACCGAG 20
miR1169 TGAGGATGTGCTTGCTTGACT 22
miR1170 TGTCCATCGGAGTTGCAG 19
miR1171 TGGAGTGGAAGAGGGAGTGG 21
miR1172 TGATCGTAGACGCAGTGAG 19
miR1212 CGTGGACAGCATACAAGTGAG 22
miR1214 TACTCATGTAGACCTCGCGGCC 23
miR1216 GATGGGACGAGCTTGTATC 19
miR1217 ATTTGAAGCTGATCGTCAG 20
miR1220 TCCGGTGTAGGAAGATAGA 20
miR1221 TGGGATGGTGTCAGGGTCTA 21
miR1222 TTGGAGAGTTCATGGCATA 20
miR1223 TTTTGATATGCACCTCTG 19
miR1309 TGACGGCGCTTTTGAAGGA 20
miR1318 TCGAGGACGACGATGCACCGAC 23
miR1427 TACGGAACCGTGGGGGCC 19
miR1428 TAAGACAAGCCATGATTCGA 21
miR1430 TGGGAGACGTTCCTGGCTGAG 22
miR1431 TTTGGAGTTGGCCACTTC 19
miR1432 ACAGGACGACGACACCGAC 20
miR1433 TGGCAAGCCGTCGGCTACCC 21
miR1441 GCCTGATGTCGGAAGAAGGTT 22
miR1444 TCCAATTCGTCAACGTTA 19
miR1445 TCCGCGTTAGTCTAGAAAAA 21
miR1507 GAGTATGATGGGAACCGAAAGAT 24
miR1508 TAGAAAGGGAAAAAGCATT 20
miR1510 CGGAGGAAAGGAAATCAAC 20
miR1511 AACCAGGCTCCGTAACTG 19
miR1513 TGTAGAAAGCCATGCCTTCAC 22
miR1517 AGCTCTTGGTCAATGTCTCAAC 23
miR1520 ATCAGAACTGGTACGGACAA 21
miR1521 TGTTAATCTGAAAATCTTGA 21
miR1524 CGAAGCCCGAGGAAGAACGTCC 23
miR1526 CGCGGTTAAGAGGAAAATGAAGAA 25
miR1533 ATAAGGAAAAATAAAATGG 20
miR1534 TATTCTGGTACATAGTCAAT 21
miR1535 CTTGTTGTCGCTGATGTC 19
miR156 TGCCGGAAGAGAGAGACACAC 21
miR157 TGACAGAAGCAGTAGAAAGCA 21
miR159 CTGGGGGACGGGAGCTCGCT 21
miR160 TGCCTTGACTCCTGAATGCCC 22
miR161 TGACAGTGATCGTCGGGGT 20
miR162 TCGATCTCTCTGCATCCAG 20
miR164 TAGAGAGAGCATGGTACGTCA 21
miR165 TCGGACTAGGTGCATCCCC 20
miR166 CCGGACCGGCATCACCCCG 19
miR167 TGAGCTCCAGCATGACGT 19
miR168 TGATTGGTGCAGACGAGAC 20
miR169 TGAGCGAACGAGGACTTGCCA 21
miR171 TCTTGGACGGTTCAATGATGA 20
miR172 TGACTCGTGTGATGCTGCACC 22
miR1846 TACTCCGGCGAGCAGGGATGG 22
miR1847 TAGCGTTTGCTGTAGTGGCAC 22
miR1848 CCTCGCCGGGCGGCTGCT 19
miR1851 CGTACGGGATGGCATCTCTTGGC 24
miR1855 ACCATGGAGAGACAAGAGA 20
miR1857 TGGTTTTTTGGGCTGACG 19
miR1858 AGAGGAGGACGCAGGGGG 19
miR1861 TTGGTCTTGAGGCAGGTATGG 22
miR1865 GTTATGTGATGGTGATCTCGAC 21
miR1868 GACGGAAACGAGCGAGGCAGCCA 24
miR1886 TGGAGAAGGACGATGAAACC 21
miR1919 ACGAGAGCACGGTGAAGG 19
miR2055 TTCCCGTTGGGACGGTGGTTTC 21
miR2079 AGGTGATGTTCGATGACGC 20
miR2084 CCTGATGGTCTGGATTGTCGA 22
miR2086 GACAATGAATTCGACTGGAA 21
miR2089 CGGATTGGTGAAAGGCAAAA 21
miR2091 TCGAGGACGCCGAGGAGGAGG 22
miR2092 GAACTGAGGTCGTGTTTAT 19
miR2094 TGGAGCTGTGGCATCCATCG 20
miR2098 TCCTGGAGGCGGACGATG 19
miR2099 ACAAAGTTGACGTTATTC 19
miR2102 AGGGCCAAGCCGGAGCCGCCAC 23
miR2108 TAATGTTCGTGCTTGTCGG 20
miR2109 TGCTGAGTGCTCTCGCCTCTA 22
miR319 TCGGACTGCAGGGAGCATCGC 21
miR390 GAGCAGGAGGTGATAGCCC 20
miR391 TTCCGGAGAGATCGCGCCT 20
miR394 TTCGGCATTGTGTCCACCACAC 23
miR395 TAGAAGCGTTTGGGGCAAC 20
miR396 TACCACGGCTTTCTGATGAAC 22
miR397 TGTTGAGGGCTATCGTTGATG 20
miR398 GGCTATCTGAGAACACGGA 20
miR399 TGCCGAAGGAGGAGCTGCTTG 22
miR401 GAAAATGGTCGTCGACCGCA 21
miR408 TGTACTCCTCGTCCTGGCT 20
miR414 TCATTCCAGTCATCGTCGTCC 22
miR415 TAAAGAACAGAGCACGAGCAG 22
miR416 TTTTGTCGTACACTGTGCA 20
miR418 TAATGTGCGGATGAAAATGAC 22
miR419 TGGATGAGGATGACGAGTAT 20
miR420 TCAACTAAACGGAAATGA 19
miR439 TCTCAACCGCAGTTGTTCCGA 22
miR444 TGCAGTGTTGCCCAAGCGT 20
miR473 ATCTCGGTCAGGCTTCCA 19
miR474 CAAAGTTTTTGGGTTCTGGGGG 23
miR477 TTCTCGTCAAAGGCTCCA 19
miR482 TCATCCCTCTCCTCCCTG 19
miR528 TGAAGGGGATGCTAGAAGGAG 21
miR529 TCGACGAGAAAGAGCACGCCC 22
miR530 ATGGCAAGGCAATGCAAC 19
miR531 CCCGCCGAGGTCGTGCCG 19
miR533 CTCAGACAGGTGCTGCATGGCTGTC 26
miR535 TGAACCGAGGAGAGCAAGCT 20
miR536 TCATGTCAAGTTGGGCATC 20
miR777 TACGCTTGGTTTCGTAGCTC 21
miR779 TCTGTGATGTTGACTGCTCAT 22
miR780 TCTGCAACGTTGAGCAGGCT 21
miR815 AGGGGGATTGGAGATGGG 19
miR817 TCCGACTTGTGCGCCCGATTGA 23
miR820 TCTGCGTGTAGGATGGACCAG 22
miR822 TGACGGGATGCAATGCACATG 22
miR824 TGACCGGTTTGTGAGCAGGGA 22
miR826 TAGTCGAGTTCTTGGATACGG 22
miR832 TGCTTGGACGGGGATCGCAAA 21
miR834 TGGACAGTGGCGTGGTAA 19
miR835 TGGAGAAACACGGAGAGAAAG 22
miR839 TTACCCAACGTTTCATCGTTCC 23
miR842 TCATGGTCAGGATCCAGCATC 22
miR843 TTAGGTCGGCGTCATGGA 19
miR844 TGGATGATTGCTTATACT 19
miR845 TACTCTGATCCCAATCGATGA 22
miR851 TCTCGGTCGCGTCGGCACAAG 22
miR854 GAGAGGTAGGGCATGAGGAG 21
miR858 TTTCTGTTTCGTCGACCTT 20
miR863 TCTGAGAGCAACAGCCATAGT 22
miR865 ATCATTTGGACTAATTGG 19
miR869 TCTGTTGTGGAGTAGTTGA 20
miR893 CTTGGGCCTGTGCTGGCGAC 21
miR894 CTTGCTACGTCGGCTTCACC 21
miR896 GTCTGTGGCCGAGCGGTTAAGG 23
miR898 CTAGGCAGTCAGAGGCGATA 21
miR900 TGAGTTCTGTGCACCTGGGAG 22
miR902 TGAGGGTCTGCATAGAGC 19
miR905 AGGACGACCTGGGTATGGCACC 23
miR906 CGGTGGGATGGGCGTATCGC 21
miR907 TCTTCTGTGAGACCGTCGAGC 21
miR908 ACAACGTCATAAGGCGAG 19
miR909 TGCAGGGTCAGTTGGCATG 20
miR910 AGCGGCGCTCGGGCTGACGC 21
miR911 ACAATTTTGTCGGCCATTT 20
miR912 TGGAAGATCCCAGACAAGGC 21
miR913 TGCACACTGCGCTCGTGG 19
miR916 CAAGAGGTCGTCGGTTCGATC 22
miR917 TTCACGGTTCTGGTCGAG 19
miR918 TCTGAAGCGGGACATCTGGC 20
miR919 TCTCGGAAGACATCGCGCAT 21
miR947 CATCGGAACTGTTACGCGTATC 23
miR948 TCGACTCGTTGGGATCCGG 20
miR950 TCAGGTCCTCGGGCGTTA 19
miR951 TTGTTCTTGACGTTGGACGCC 22
miR952 AACTGTAGAACTGCCATTGAT 22